ID: 1023737620_1023737633

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1023737620 1023737633
Species Human (GRCh38) Human (GRCh38)
Location 7:43248756-43248778 7:43248788-43248810
Sequence CCCCATCTCCCCGTTCTCCTCCT CCCCCTCCTCATAGTTTTCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 7, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!