ID: 1023737625_1023737639

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1023737625 1023737639
Species Human (GRCh38) Human (GRCh38)
Location 7:43248766-43248788 7:43248801-43248823
Sequence CCGTTCTCCTCCTGTTTCCCCTC GTTTTCAGGGTCGGAGTCCTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 23, 3: 262, 4: 1865} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!