ID: 1023737698_1023737714

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1023737698 1023737714
Species Human (GRCh38) Human (GRCh38)
Location 7:43249104-43249126 7:43249157-43249179
Sequence CCCTAGGTGCCGGGCGCCGCCCG GCGGAGCCTTGGCTGCGGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 70} {0: 1, 1: 0, 2: 1, 3: 17, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!