ID: 1023737702_1023737714

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1023737702 1023737714
Species Human (GRCh38) Human (GRCh38)
Location 7:43249123-43249145 7:43249157-43249179
Sequence CCCGTCCCCACCTCCATCAGAAC GCGGAGCCTTGGCTGCGGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 574} {0: 1, 1: 0, 2: 1, 3: 17, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!