|
Left Crispr |
Right Crispr |
| Crispr ID |
1023774859 |
1023774863 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:43595536-43595558
|
7:43595561-43595583
|
| Sequence |
CCCAAAATGCTGAGATTACAAAG |
GCACCATGCCTGGCTTCAACTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 24, 2: 515, 3: 7756, 4: 74797} |
{0: 1, 1: 0, 2: 6, 3: 75, 4: 390} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|