ID: 1023777301_1023777306

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1023777301 1023777306
Species Human (GRCh38) Human (GRCh38)
Location 7:43620091-43620113 7:43620114-43620136
Sequence CCAAGTCTGAGGCTCCATAGAAG TGTGGAGCAGAGAGGGCATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 111} {0: 1, 1: 0, 2: 3, 3: 32, 4: 384}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!