ID: 1023824844_1023824850

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1023824844 1023824850
Species Human (GRCh38) Human (GRCh38)
Location 7:44002119-44002141 7:44002156-44002178
Sequence CCAACATGGTGAAACCCTGTCTC AAATGAGCTGGGCGTTCTGGTGG
Strand - +
Off-target summary {0: 31762, 1: 84237, 2: 130975, 3: 115475, 4: 69762} {0: 7, 1: 4, 2: 346, 3: 13246, 4: 49677}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!