ID: 1023824845_1023824849

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1023824845 1023824849
Species Human (GRCh38) Human (GRCh38)
Location 7:44002133-44002155 7:44002153-44002175
Sequence CCCTGTCTCTTCTAGAAGCACAA CAAAAATGAGCTGGGCGTTCTGG
Strand - +
Off-target summary {0: 8, 1: 0, 2: 152, 3: 5593, 4: 80206} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!