ID: 1023824845_1023824852

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1023824845 1023824852
Species Human (GRCh38) Human (GRCh38)
Location 7:44002133-44002155 7:44002180-44002202
Sequence CCCTGTCTCTTCTAGAAGCACAA CACCTGTAATCCCAGCTACTTGG
Strand - +
Off-target summary {0: 8, 1: 0, 2: 152, 3: 5593, 4: 80206} {0: 27298, 1: 77225, 2: 165100, 3: 221696, 4: 302720}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!