ID: 1023845720_1023845724

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1023845720 1023845724
Species Human (GRCh38) Human (GRCh38)
Location 7:44119103-44119125 7:44119120-44119142
Sequence CCCGTGGAGTCAGGTGGCTTTGT CTTTGTTTACCCAGGGCACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 145} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!