ID: 1023855064_1023855068

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1023855064 1023855068
Species Human (GRCh38) Human (GRCh38)
Location 7:44177908-44177930 7:44177932-44177954
Sequence CCTAACACAGTATACCAGGGGTG TCCTAGAAATCAGCCTATGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 80} {0: 1, 1: 0, 2: 2, 3: 11, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!