ID: 1023862377_1023862380

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1023862377 1023862380
Species Human (GRCh38) Human (GRCh38)
Location 7:44224403-44224425 7:44224426-44224448
Sequence CCTGCTGGCTGAGGACAAGCTGT CCTGGCAGTTCCAGAGACAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 18, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!