ID: 1023862377_1023862384

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1023862377 1023862384
Species Human (GRCh38) Human (GRCh38)
Location 7:44224403-44224425 7:44224434-44224456
Sequence CCTGCTGGCTGAGGACAAGCTGT TTCCAGAGACAAAGGGGAGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 3, 3: 65, 4: 524}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!