ID: 1023862377_1023862390

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1023862377 1023862390
Species Human (GRCh38) Human (GRCh38)
Location 7:44224403-44224425 7:44224448-44224470
Sequence CCTGCTGGCTGAGGACAAGCTGT GGGAGGTGGTGGGCAGGGCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 23, 3: 258, 4: 1830}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!