ID: 1023877082_1023877087

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1023877082 1023877087
Species Human (GRCh38) Human (GRCh38)
Location 7:44292588-44292610 7:44292609-44292631
Sequence CCTTCCTTTCTTTAACTGCAGGA GACTTCTCAGGGCCTTGAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 289} {0: 1, 1: 2, 2: 4, 3: 24, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!