ID: 1023877281_1023877283

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1023877281 1023877283
Species Human (GRCh38) Human (GRCh38)
Location 7:44293907-44293929 7:44293928-44293950
Sequence CCTCAGGGACCTCACATCTCACA CACTGCCCAGACCCACTGCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 52, 4: 370}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!