ID: 1023880809_1023880816

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1023880809 1023880816
Species Human (GRCh38) Human (GRCh38)
Location 7:44320290-44320312 7:44320334-44320356
Sequence CCAAGGACAGGTGCCCAAAAGCC GCTGGCCATGAGTCAGCCAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 16, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!