ID: 1023884627_1023884629

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1023884627 1023884629
Species Human (GRCh38) Human (GRCh38)
Location 7:44344560-44344582 7:44344573-44344595
Sequence CCTGCTTGGGGTTACTGAGTATC ACTGAGTATCTTGAGTTTGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 27, 4: 231}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!