ID: 1023910365_1023910366

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1023910365 1023910366
Species Human (GRCh38) Human (GRCh38)
Location 7:44551111-44551133 7:44551134-44551156
Sequence CCATTTTCAATAATTGATGGAAC AACTAGCCACAAGACCAGTAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 7, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!