ID: 1023921560_1023921567

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1023921560 1023921567
Species Human (GRCh38) Human (GRCh38)
Location 7:44634073-44634095 7:44634105-44634127
Sequence CCCACTGCCAGCTCCCTTGGAGC CACCAGGCTAGAAGCCATGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 18, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!