ID: 1023926789_1023926797

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1023926789 1023926797
Species Human (GRCh38) Human (GRCh38)
Location 7:44675321-44675343 7:44675341-44675363
Sequence CCCTGGCTCCACTTCTTTCTTAG TAGAATGACTTACGGGGGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 308} {0: 1, 1: 0, 2: 0, 3: 3, 4: 49}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!