ID: 1023935563_1023935574

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1023935563 1023935574
Species Human (GRCh38) Human (GRCh38)
Location 7:44737534-44737556 7:44737570-44737592
Sequence CCTGCCCACCTGCACCAACTTAG CTGGCCCACAGGAAGTTCTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 35, 4: 308}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!