ID: 1023935566_1023935574

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1023935566 1023935574
Species Human (GRCh38) Human (GRCh38)
Location 7:44737542-44737564 7:44737570-44737592
Sequence CCTGCACCAACTTAGCCCATGAG CTGGCCCACAGGAAGTTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 97} {0: 1, 1: 0, 2: 2, 3: 35, 4: 308}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!