ID: 1023940741_1023940754

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1023940741 1023940754
Species Human (GRCh38) Human (GRCh38)
Location 7:44767161-44767183 7:44767207-44767229
Sequence CCACCAGCATTCACCTTGGGGCA GCTGATGCACAGAGGGAGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 145} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!