ID: 1023996449_1023996457

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1023996449 1023996457
Species Human (GRCh38) Human (GRCh38)
Location 7:45161783-45161805 7:45161815-45161837
Sequence CCAGGTCTAGGGGTTCAGATTCA GTCCAGGTGGACCAGGCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 122} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!