ID: 1024023550_1024023560

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1024023550 1024023560
Species Human (GRCh38) Human (GRCh38)
Location 7:45391896-45391918 7:45391926-45391948
Sequence CCTGGGCCACATTTGCCATGGCA TAGGCACCTTGGCCTGGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 167} {0: 1, 1: 0, 2: 1, 3: 24, 4: 272}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!