ID: 1024023605_1024023614

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1024023605 1024023614
Species Human (GRCh38) Human (GRCh38)
Location 7:45392160-45392182 7:45392206-45392228
Sequence CCTGGCCACTGCCTGGCTCAGCA CACAGATGGGGCCCCCGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 69, 4: 459} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!