ID: 1024023607_1024023612

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1024023607 1024023612
Species Human (GRCh38) Human (GRCh38)
Location 7:45392171-45392193 7:45392204-45392226
Sequence CCTGGCTCAGCAGCTGCAGCAGA GTCACAGATGGGGCCCCCGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 10, 3: 86, 4: 572} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!