ID: 1024034325_1024034335

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1024034325 1024034335
Species Human (GRCh38) Human (GRCh38)
Location 7:45494919-45494941 7:45494965-45494987
Sequence CCCAGTCAGGAAGCACAGGATCA TGGCTGCCCCTTTGTGGAGGGGG
Strand - +
Off-target summary {0: 3, 1: 14, 2: 76, 3: 157, 4: 406} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!