ID: 1024048603_1024048611

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1024048603 1024048611
Species Human (GRCh38) Human (GRCh38)
Location 7:45601998-45602020 7:45602038-45602060
Sequence CCTTGACTGAACCGAATAGGGAC AAGAGTGATCAGGGCTTTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 29} {0: 1, 1: 0, 2: 3, 3: 20, 4: 253}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!