ID: 1024073109_1024073119

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1024073109 1024073119
Species Human (GRCh38) Human (GRCh38)
Location 7:45802760-45802782 7:45802796-45802818
Sequence CCAGGGTCGTGGTGGTGTTGAGA GAGAAGTAGGGGAGGAGGCCAGG
Strand - +
Off-target summary No data {0: 13, 1: 15, 2: 16, 3: 96, 4: 958}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!