ID: 1024081737_1024081742

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1024081737 1024081742
Species Human (GRCh38) Human (GRCh38)
Location 7:45862290-45862312 7:45862320-45862342
Sequence CCAGGTGTGGTGACTCCTGGAGA GCCATGCAGTGTGGGTGGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 305} {0: 1, 1: 0, 2: 1, 3: 17, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!