ID: 1024082446_1024082458

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1024082446 1024082458
Species Human (GRCh38) Human (GRCh38)
Location 7:45866264-45866286 7:45866313-45866335
Sequence CCTTTTCCTAACAGTGGCTGGAG AGGTCCTGAGAGAAGTGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 163} {0: 1, 1: 0, 2: 0, 3: 25, 4: 251}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!