ID: 1024087829_1024087834

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1024087829 1024087834
Species Human (GRCh38) Human (GRCh38)
Location 7:45911375-45911397 7:45911399-45911421
Sequence CCACGTTCCGGTCCTGGATTTCC GACACTTGGCCTCGCTCCCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 7, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!