ID: 1024088851_1024088864

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1024088851 1024088864
Species Human (GRCh38) Human (GRCh38)
Location 7:45919607-45919629 7:45919639-45919661
Sequence CCCAGTGACATCTGTCCAACGTG GAGTTGGGGGAATTAGGATGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 31, 4: 337}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!