ID: 1024143887_1024143893

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1024143887 1024143893
Species Human (GRCh38) Human (GRCh38)
Location 7:46491464-46491486 7:46491505-46491527
Sequence CCAAAGAATAGCCATGATGTGGC CTGTGGTAAAAATCCAGGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 99} {0: 1, 1: 0, 2: 0, 3: 34, 4: 295}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!