ID: 1024161463_1024161467

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1024161463 1024161467
Species Human (GRCh38) Human (GRCh38)
Location 7:46680642-46680664 7:46680659-46680681
Sequence CCGCACACCAATAATTAGAATCA GAATCACTTAGAAGGAGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 203} {0: 1, 1: 0, 2: 2, 3: 19, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!