ID: 1024163801_1024163807

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1024163801 1024163807
Species Human (GRCh38) Human (GRCh38)
Location 7:46709260-46709282 7:46709298-46709320
Sequence CCACCTGTCTTCTGCTGAAAGGG GGCATTTGATTAGAATGATTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 19, 4: 225} {0: 3, 1: 13, 2: 17, 3: 30, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!