ID: 1024190069_1024190072

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1024190069 1024190072
Species Human (GRCh38) Human (GRCh38)
Location 7:46997106-46997128 7:46997119-46997141
Sequence CCTTCTACAACCTCATTAATCCA CATTAATCCAACAAGTTTCTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!