ID: 1024201040_1024201048

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1024201040 1024201048
Species Human (GRCh38) Human (GRCh38)
Location 7:47106003-47106025 7:47106046-47106068
Sequence CCTGCAACGACCCTGGACGTTTT GTGAGCAGTGCTCACACAGCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!