ID: 1024239576_1024239583

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1024239576 1024239583
Species Human (GRCh38) Human (GRCh38)
Location 7:47423960-47423982 7:47423998-47424020
Sequence CCACCTTCACAGTCTTTGGCATG TCATTTAGGTGTCGGGACAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 195} {0: 1, 1: 0, 2: 1, 3: 5, 4: 96}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!