ID: 1024246744_1024246750

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1024246744 1024246750
Species Human (GRCh38) Human (GRCh38)
Location 7:47476501-47476523 7:47476554-47476576
Sequence CCCATAGAACGGTAATGTAAGCA AAAAGCCAGAGGTCCCAATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 109} {0: 1, 1: 0, 2: 3, 3: 28, 4: 246}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!