ID: 1024248413_1024248422

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1024248413 1024248422
Species Human (GRCh38) Human (GRCh38)
Location 7:47488268-47488290 7:47488320-47488342
Sequence CCTCATTCCCAGTGCTGACACTG ACAGTCTTAGCTCGGGTAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 34, 4: 275} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!