|
Left Crispr |
Right Crispr |
| Crispr ID |
1024254277 |
1024254292 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:47528243-47528265
|
7:47528288-47528310
|
| Sequence |
CCATCACAGGCACCCTACTCTAA |
CTGGGGGTCTGCAGGGAAGGAGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 1, 1: 1, 2: 11, 3: 90, 4: 709} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|