ID: 1024254285_1024254292

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1024254285 1024254292
Species Human (GRCh38) Human (GRCh38)
Location 7:47528271-47528293 7:47528288-47528310
Sequence CCATCAGGGACCATCTGCTGGGG CTGGGGGTCTGCAGGGAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 217} {0: 1, 1: 1, 2: 11, 3: 90, 4: 709}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!