ID: 1024272797_1024272800

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1024272797 1024272800
Species Human (GRCh38) Human (GRCh38)
Location 7:47655267-47655289 7:47655295-47655317
Sequence CCGGGCAGTGGGATGAGGATGGC CAGAGTCAACAGAAGGAAGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 350} {0: 1, 1: 0, 2: 3, 3: 56, 4: 519}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!