|
Left Crispr |
Right Crispr |
Crispr ID |
1024298931 |
1024298940 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
7:47870805-47870827
|
7:47870852-47870874
|
Sequence |
CCTGGGCAACATGATGAAATTAG |
AATCCCAGCTACTTGGGAGGCGG |
Strand |
- |
+ |
Off-target summary |
No data |
{0: 374, 1: 1004, 2: 1942, 3: 6302, 4: 6082} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|