ID: 1024298931_1024298940

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1024298931 1024298940
Species Human (GRCh38) Human (GRCh38)
Location 7:47870805-47870827 7:47870852-47870874
Sequence CCTGGGCAACATGATGAAATTAG AATCCCAGCTACTTGGGAGGCGG
Strand - +
Off-target summary No data {0: 374, 1: 1004, 2: 1942, 3: 6302, 4: 6082}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!