|
Left Crispr |
Right Crispr |
| Crispr ID |
1024298935 |
1024298942 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:47870828-47870850
|
7:47870855-47870877
|
| Sequence |
CCAGGCATGGTGGCATGTGCCTA |
CCCAGCTACTTGGGAGGCGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 248, 1: 3128, 2: 13570, 3: 41847, 4: 90675} |
{0: 388, 1: 92154, 2: 204481, 3: 251399, 4: 391713} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|