ID: 1024298935_1024298944

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1024298935 1024298944
Species Human (GRCh38) Human (GRCh38)
Location 7:47870828-47870850 7:47870858-47870880
Sequence CCAGGCATGGTGGCATGTGCCTA AGCTACTTGGGAGGCGGAGGTGG
Strand - +
Off-target summary {0: 248, 1: 3128, 2: 13570, 3: 41847, 4: 90675} {0: 71, 1: 13183, 2: 28631, 3: 47579, 4: 211466}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!