ID: 1024312204_1024312207

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1024312204 1024312207
Species Human (GRCh38) Human (GRCh38)
Location 7:47979590-47979612 7:47979605-47979627
Sequence CCCGGAAACACGGCAGCGCGAAC GCGCGAACAGTGGTTCCGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 32} {0: 1, 1: 0, 2: 0, 3: 0, 4: 16}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!